|
Left Crispr |
Right Crispr |
| Crispr ID |
995398652 |
995398669 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:111716786-111716808
|
5:111716836-111716858
|
| Sequence |
CCCACAGCCATCCCTTCCCCCAG |
TTATCTACAAGCCCCTGACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 186, 2: 393, 3: 585, 4: 1205} |
{0: 14, 1: 486, 2: 645, 3: 496, 4: 306} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|