|
Left Crispr |
Right Crispr |
Crispr ID |
995398653 |
995398669 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:111716787-111716809
|
5:111716836-111716858
|
Sequence |
CCACAGCCATCCCTTCCCCCAGG |
TTATCTACAAGCCCCTGACTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 178, 2: 398, 3: 623, 4: 1360} |
{0: 14, 1: 486, 2: 645, 3: 496, 4: 306} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|