ID: 995398666_995398669

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 995398666 995398669
Species Human (GRCh38) Human (GRCh38)
Location 5:111716818-111716840 5:111716836-111716858
Sequence CCCAGGAAGATGGTGGTTTTATC TTATCTACAAGCCCCTGACTGGG
Strand - +
Off-target summary No data {0: 14, 1: 486, 2: 645, 3: 496, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!