ID: 995399129_995399134

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 995399129 995399134
Species Human (GRCh38) Human (GRCh38)
Location 5:111720720-111720742 5:111720746-111720768
Sequence CCAACACTAGCTTTCCTGGGTCT GCTTGAAGATGGCAGATCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 31, 2: 124, 3: 330, 4: 813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!