ID: 995405694_995405698

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 995405694 995405698
Species Human (GRCh38) Human (GRCh38)
Location 5:111793074-111793096 5:111793100-111793122
Sequence CCACAAGTCACCCAGTAAACTAG CTGTAAATTCAAATGAAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171} {0: 1, 1: 0, 2: 4, 3: 32, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!