ID: 995427734_995427736

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 995427734 995427736
Species Human (GRCh38) Human (GRCh38)
Location 5:112043728-112043750 5:112043755-112043777
Sequence CCAAGAGCTTTGTCTCAAAAGGA AGTTATTTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 217, 3: 266, 4: 327} {0: 8, 1: 196, 2: 191, 3: 115, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!