ID: 995443801_995443812

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 995443801 995443812
Species Human (GRCh38) Human (GRCh38)
Location 5:112220781-112220803 5:112220824-112220846
Sequence CCTTCTTCCTCCTTTTTCCCCTG ATCCTGCTTTACCCAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 190, 4: 1653} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!