ID: 995447775_995447780

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 995447775 995447780
Species Human (GRCh38) Human (GRCh38)
Location 5:112265570-112265592 5:112265623-112265645
Sequence CCAACCCACTTCATCTATGACAT TTAGTCTGCAAGTGCCACAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 189} {0: 1, 1: 0, 2: 3, 3: 8, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!