|
Left Crispr |
Right Crispr |
| Crispr ID |
995520973 |
995520981 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:113004999-113005021
|
5:113005034-113005056
|
| Sequence |
CCTGTAATCCCAGCTACTCTAGA |
CAGGAGAATTGCTTGAACTCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 161, 1: 10531, 2: 123266, 3: 259767, 4: 225093} |
{0: 2028, 1: 37293, 2: 109292, 3: 210933, 4: 194091} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|