|
Left Crispr |
Right Crispr |
| Crispr ID |
995520978 |
995520982 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:113005027-113005049
|
5:113005043-113005065
|
| Sequence |
CCCGAGGCAGGAGAATTGCTTGA |
TGCTTGAACTCGGGAAGCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 578, 1: 1511, 2: 2638, 3: 2413, 4: 2613} |
{0: 29, 1: 875, 2: 10608, 3: 47110, 4: 99247} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|