ID: 995528529_995528536

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 995528529 995528536
Species Human (GRCh38) Human (GRCh38)
Location 5:113070010-113070032 5:113070052-113070074
Sequence CCTTATCCATGAGGTTGTACTAA GCTCAAAGGCAGATTGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 1, 1: 0, 2: 0, 3: 10, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!