ID: 995569443_995569449 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 995569443 | 995569449 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:113463914-113463936 | 5:113463953-113463975 |
| Sequence | CCTGCAAAGGAGATAGAAAGGAA | GAGAACAGCAAGAAGACTGTGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 2, 3: 30, 4: 310} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||