ID: 995591386_995591389

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 995591386 995591389
Species Human (GRCh38) Human (GRCh38)
Location 5:113703947-113703969 5:113703984-113704006
Sequence CCCATTTCAATATCTTCATTTTG AACCCAATAAGTATCAATCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 81, 4: 855} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!