ID: 995591386_995591392

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 995591386 995591392
Species Human (GRCh38) Human (GRCh38)
Location 5:113703947-113703969 5:113703988-113704010
Sequence CCCATTTCAATATCTTCATTTTG CAATAAGTATCAATCTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 81, 4: 855} {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!