ID: 995608012_995608019

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 995608012 995608019
Species Human (GRCh38) Human (GRCh38)
Location 5:113879238-113879260 5:113879274-113879296
Sequence CCAATTAAATCTCTTTCCAATAT AATTGGTACCACAAAGAGTGGGG
Strand - +
Off-target summary No data {0: 7, 1: 69, 2: 113, 3: 150, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!