ID: 995608020_995608028

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 995608020 995608028
Species Human (GRCh38) Human (GRCh38)
Location 5:113879282-113879304 5:113879327-113879349
Sequence CCACAAAGAGTGGGGCGCTGCTG TGACTTTGGAACCAGGTAACAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 34, 3: 88, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!