ID: 995619731_995619738

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 995619731 995619738
Species Human (GRCh38) Human (GRCh38)
Location 5:114011486-114011508 5:114011514-114011536
Sequence CCTCCTAGAGATTCCATCAGCCT TCTCAAGCTACTCAGGGCCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!