ID: 995653730_995653735

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 995653730 995653735
Species Human (GRCh38) Human (GRCh38)
Location 5:114401403-114401425 5:114401455-114401477
Sequence CCACAAGCACATTTAATTGATAT CTGTTAACTGAGAAATAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 208} {0: 1, 1: 0, 2: 1, 3: 31, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!