ID: 995725551_995725553

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 995725551 995725553
Species Human (GRCh38) Human (GRCh38)
Location 5:115178278-115178300 5:115178294-115178316
Sequence CCTATCAAGAGTAGTCCATTTAT CATTTATTTTGTTCAACCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131} {0: 1, 1: 0, 2: 1, 3: 27, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!