ID: 995805796_995805801

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 995805796 995805801
Species Human (GRCh38) Human (GRCh38)
Location 5:116051185-116051207 5:116051238-116051260
Sequence CCTGCTTAAGAGAGGTTTATGAT TCTCCTGGAACCCCCGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95} {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!