ID: 995827534_995827539

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 995827534 995827539
Species Human (GRCh38) Human (GRCh38)
Location 5:116317395-116317417 5:116317446-116317468
Sequence CCTACAGCATGTTGCTGTTGAAC AGTAACAGAGCAGAGTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 41, 4: 184} {0: 1, 1: 22, 2: 56, 3: 73, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!