ID: 995833244_995833251

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 995833244 995833251
Species Human (GRCh38) Human (GRCh38)
Location 5:116376498-116376520 5:116376514-116376536
Sequence CCTGAAACTAGAAGAGGATTCAA GATTCAAGGGAGCAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 285} {0: 1, 1: 0, 2: 5, 3: 35, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!