ID: 995834901_995834910

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 995834901 995834910
Species Human (GRCh38) Human (GRCh38)
Location 5:116390317-116390339 5:116390341-116390363
Sequence CCTGCTAGGCCACACCAACCCTG GTTCTAGACTGTAAACACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!