ID: 995852345_995852350

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 995852345 995852350
Species Human (GRCh38) Human (GRCh38)
Location 5:116559469-116559491 5:116559484-116559506
Sequence CCTGCCCCATCCGCACTTGGGGC CTTGGGGCTGACGCCGTTTTAGG
Strand - +
Off-target summary No data {0: 2, 1: 11, 2: 47, 3: 49, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!