ID: 995947970_995947977

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 995947970 995947977
Species Human (GRCh38) Human (GRCh38)
Location 5:117672906-117672928 5:117672947-117672969
Sequence CCCTTTTCCCTTCACAGCCAAAG CTCAAGAACATAGGTTCTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!