ID: 995951695_995951698

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 995951695 995951698
Species Human (GRCh38) Human (GRCh38)
Location 5:117721929-117721951 5:117721971-117721993
Sequence CCTCTAACAGTGCATCATGGACA CTTGAACCATGTAATTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 103} {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!