ID: 996021535_996021543

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 996021535 996021543
Species Human (GRCh38) Human (GRCh38)
Location 5:118595955-118595977 5:118595999-118596021
Sequence CCCTGTCTTCACACAGCCTCTCA ACGTTTCCTTCTCCTTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 401} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!