ID: 996035705_996035718

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 996035705 996035718
Species Human (GRCh38) Human (GRCh38)
Location 5:118756535-118756557 5:118756583-118756605
Sequence CCATCCTCCTTGCTAACAGAACC CCAGTCCCATGGGATGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 25, 3: 86, 4: 377} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!