ID: 996037163_996037165

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 996037163 996037165
Species Human (GRCh38) Human (GRCh38)
Location 5:118771327-118771349 5:118771342-118771364
Sequence CCATTAAATGTCTTTTGGAAAAA TGGAAAAATCACAATGTGGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!