ID: 996054325_996054329 |
View in Genome Browser |
Spacer: 10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 996054325 | 996054329 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:118966707-118966729 | 5:118966740-118966762 |
| Sequence | CCTAACAGTTCTCCATAATTACA | CAATCAGAGGCCAGGCACAGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 22, 2: 178, 3: 1325, 4: 6336} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||