ID: 996066090_996066096

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 996066090 996066096
Species Human (GRCh38) Human (GRCh38)
Location 5:119080917-119080939 5:119080948-119080970
Sequence CCCTCCCTAGGCAAAAAAGATGT CTAACTCATCCCTAAAGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 170} {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!