ID: 996066093_996066096

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 996066093 996066096
Species Human (GRCh38) Human (GRCh38)
Location 5:119080922-119080944 5:119080948-119080970
Sequence CCTAGGCAAAAAAGATGTAAATC CTAACTCATCCCTAAAGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 312} {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!