|
Left Crispr |
Right Crispr |
| Crispr ID |
996066287 |
996066288 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:119083169-119083191
|
5:119083195-119083217
|
| Sequence |
CCTGGCTAATTTTGTATATACAC |
TATATATTTTTTAGTAGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 24, 3: 1089, 4: 19212} |
{0: 64, 1: 580, 2: 10524, 3: 15076, 4: 34627} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|