ID: 996088348_996088355

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 996088348 996088355
Species Human (GRCh38) Human (GRCh38)
Location 5:119326528-119326550 5:119326565-119326587
Sequence CCCCTGAGCAGCAGGGAAGCATT AGAGGGTAACATGGTGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 231} {0: 1, 1: 0, 2: 4, 3: 62, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!