ID: 996176494_996176501

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 996176494 996176501
Species Human (GRCh38) Human (GRCh38)
Location 5:120365906-120365928 5:120365952-120365974
Sequence CCAATCACTGAGATGATGAGTAT AGGTGTGGCAGCTGAGGAGATGG
Strand - +
Off-target summary {0: 9, 1: 25, 2: 121, 3: 204, 4: 429} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!