ID: 996195392_996195395

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 996195392 996195395
Species Human (GRCh38) Human (GRCh38)
Location 5:120600140-120600162 5:120600190-120600212
Sequence CCCAGCTCCATTTTTGTTTAATT ATATTATCTACTATGTTTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 113, 4: 1110} {0: 1, 1: 0, 2: 3, 3: 29, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!