ID: 996201952_996201957

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 996201952 996201957
Species Human (GRCh38) Human (GRCh38)
Location 5:120686341-120686363 5:120686372-120686394
Sequence CCAGTCCAGCTTCTGATGCATAG AAGACAGATGTCCCCAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 115} {0: 1, 1: 0, 2: 5, 3: 38, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!