|
Left Crispr |
Right Crispr |
| Crispr ID |
996316695 |
996316701 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:122168450-122168472
|
5:122168465-122168487
|
| Sequence |
CCTGTAATCCCAGCACTTTGTGA |
CTTTGTGAGGCCAAGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1786, 1: 298626, 2: 265319, 3: 148850, 4: 129231} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|