ID: 996345484_996345488

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 996345484 996345488
Species Human (GRCh38) Human (GRCh38)
Location 5:122483943-122483965 5:122483994-122484016
Sequence CCTTTTTAACAAGGGGCCCTAGA GTTAATTTTATGTGTCAATTTGG
Strand - +
Off-target summary No data {0: 29, 1: 224, 2: 526, 3: 684, 4: 988}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!