ID: 996377451_996377460

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 996377451 996377460
Species Human (GRCh38) Human (GRCh38)
Location 5:122827871-122827893 5:122827924-122827946
Sequence CCCAGTTTTAGGCCATCAGAAAC TTCTAGTTTGTTTTCCTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142} {0: 1, 1: 0, 2: 4, 3: 50, 4: 642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!