ID: 996392201_996392205 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 996392201 | 996392205 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:122973775-122973797 | 5:122973814-122973836 |
| Sequence | CCAAGTAACAGGCCAAGAGCTGT | AGTTATCTGCAGATGATGGCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 198, 2: 204, 3: 136, 4: 399} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||