|
Left Crispr |
Right Crispr |
| Crispr ID |
996406502 |
996406507 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:123110725-123110747
|
5:123110755-123110777
|
| Sequence |
CCCAGCTTATTCTGTATTTTTAG |
TGGGTTTCTCCATGTTGGTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 178, 2: 8834, 3: 22823, 4: 15304} |
{0: 349, 1: 18140, 2: 39255, 3: 147523, 4: 194301} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|