ID: 996406707_996406714

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 996406707 996406714
Species Human (GRCh38) Human (GRCh38)
Location 5:123112302-123112324 5:123112329-123112351
Sequence CCTTTCCACTTCTCCTGCCAGCC CAGTGCAGTCCTATATCATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 555} {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!