ID: 996410225_996410229

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 996410225 996410229
Species Human (GRCh38) Human (GRCh38)
Location 5:123151100-123151122 5:123151139-123151161
Sequence CCTGTATTAGATGTATGGGCATA CTCAGCTGCTTGGCGAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 109} {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!