ID: 996435744_996435754

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 996435744 996435754
Species Human (GRCh38) Human (GRCh38)
Location 5:123430882-123430904 5:123430905-123430927
Sequence CCCCTGCTCCACGGCGCCCAGTC CCATCGGCGCCCAGTCCCAAGGG
Strand - +
Off-target summary {0: 315, 1: 633, 2: 424, 3: 271, 4: 384} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!