ID: 996435745_996435754

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 996435745 996435754
Species Human (GRCh38) Human (GRCh38)
Location 5:123430883-123430905 5:123430905-123430927
Sequence CCCTGCTCCACGGCGCCCAGTCC CCATCGGCGCCCAGTCCCAAGGG
Strand - +
Off-target summary {0: 326, 1: 653, 2: 449, 3: 275, 4: 423} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!