|
Left Crispr |
Right Crispr |
| Crispr ID |
996455602 |
996455608 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:123677976-123677998
|
5:123678025-123678047
|
| Sequence |
CCAACTATGTGGTCAATTTTGGA |
ATGTATACTCTGTTGAATTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3683, 1: 3725, 2: 2513, 3: 1796, 4: 1619} |
{0: 1, 1: 123, 2: 7311, 3: 3369, 4: 1651} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|