ID: 996455602_996455608

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 996455602 996455608
Species Human (GRCh38) Human (GRCh38)
Location 5:123677976-123677998 5:123678025-123678047
Sequence CCAACTATGTGGTCAATTTTGGA ATGTATACTCTGTTGAATTGGGG
Strand - +
Off-target summary {0: 3683, 1: 3725, 2: 2513, 3: 1796, 4: 1619} {0: 1, 1: 123, 2: 7311, 3: 3369, 4: 1651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!