ID: 996510380_996510384

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 996510380 996510384
Species Human (GRCh38) Human (GRCh38)
Location 5:124309408-124309430 5:124309460-124309482
Sequence CCACGTGATTAAAAGCTTTATTG CACACAGACACACATGAAAACGG
Strand - +
Off-target summary {0: 1, 1: 246, 2: 77, 3: 22, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!