|
Left Crispr |
Right Crispr |
| Crispr ID |
996510383 |
996510384 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:124309442-124309464
|
5:124309460-124309482
|
| Sequence |
CCTGTTTGGTGGTCTCTTCACAC |
CACACAGACACACATGAAAACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|