ID: 996542117_996542121

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 996542117 996542121
Species Human (GRCh38) Human (GRCh38)
Location 5:124641290-124641312 5:124641303-124641325
Sequence CCCATGCCAACGTGGGTGTGGTG GGGTGTGGTGGTGCGTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75} {0: 1, 1: 0, 2: 6, 3: 84, 4: 727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!